Changeset 1242:a148f32ba0a0

Timestamp:

04/29/08 10:36:04 (8 months ago)

Author:

Anton Nekrutenko <anton@bx.psu.edu>

branch:

default

convert_revision:

svn:9bcadc22-80f8-0310-8a53-c8f022958886/galaxy/trunk@2603

Message:

More clean up and modification of FASTA tools

Files:

• tool_conf.xml.main (modified) (1 diff)
• tool_conf.xml.sample (modified) (1 diff)
• tools/fasta_tools/fasta_compute_length.py (modified) (2 diffs)
• tools/fasta_tools/fasta_compute_length.xml (modified) (4 diffs)
• tools/fasta_tools/fasta_concatenate_by_species.xml (modified) (3 diffs)
• tools/fasta_tools/fasta_filter_by_length.xml (modified) (5 diffs)
• tools/fasta_tools/fasta_to_tabular.py (modified) (2 diffs)
• tools/fasta_tools/fasta_to_tabular.xml (modified) (3 diffs)
• tools/fasta_tools/tabular_to_fasta.xml (modified) (2 diffs)

tool_conf.xml.main

@@ -55 +55 @@
-    <tool file="maf/maf_to_bed.xml" />
-    <tool file="maf/maf_to_fasta.xml" />
+    <tool file="fasta_tools/tabular_to_fasta.xml" />
+  </section>
+  <section name="FASTA manipulation" id="fasta_manipulation">
+    <tool file="fasta_tools/fasta_compute_length.xml" />
+    <tool file="fasta_tools/fasta_filter_by_length.xml" />
+    <tool file="fasta_tools/fasta_concatenate_by_species.xml" />
+    <tool file="fasta_tools/fasta_to_tabular.xml" />
-    <tool file="fasta_tools/tabular_to_fasta.xml" />
-  </section>

tool_conf.xml.sample

@@ -265 +265 @@
-    <tool file="fasta_tools/fasta_filter_by_length.xml" />
-    <tool file="fasta_tools/fasta_concatenate_by_species.xml" />
+    <tool file="fasta_tools/fasta_to_tabular.xml" />
+    <tool file="fasta_tools/tabular_to_fasta.xml" />
-  </section>
-  <section name="Short Read Analysis" id="short_read_analysis">

tools/fasta_tools/fasta_compute_length.py

@@ -13 +13 @@
-    input_filename = sys.argv[1]
-    output_filename = sys.argv[2]
+    keep_first = int( sys.argv[3] ) + 1
-    tmp_title = tmp_seq = ''
-    tmp_seq_count = 0
-    seq_hash = {}
+
+    if keep_first == 0:
+        keep_first = None
-
-    for i, line in enumerate( file( input_filename ) ):
@@ -39 +43 @@
-    for i, fasta_title in title_keys:
-        tmp_seq = seq_hash[ ( i, fasta_title ) ]
-
+keep_first
-    output_handle.close()
-

tools/fasta_tools/fasta_compute_length.xml

@@ -1 @@
-unt FASTA Length
- 
-
+mpute
+sequence length
+$keep_first
-        <inputs>
-
+
+
-        </inputs>
-        <outputs>
@@ -11 +12 @@
-                <test>
-                        <param name="input" value="454.fasta" />
+                        <param name="keep_first" value="0"/>
-                        <output name="output" file="fasta_tool_compute_length_1.out" />
-                </test>
-                <test>
-                        <param name="input" value="extract_genomic_dna_out1.fasta" />
+                        <param name="keep_first" value="0"/>
-                        <output name="output" file="fasta_tool_compute_length_2.out" />
-                </test>
@@ -22 +25 @@
-**What it does**
-
- This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences
+This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry
-
------   
@@ -28 +31 @@
-**Example**
-
-- assume the input file contains fasta sequences
+Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run
-
-
-
-
-
-
-
+
+
+
+
+
-
-- the tool will return(first column is the titles, second column is the length of the sequences)
+Running this tool while setting **How many characters to keep?** to **14** will produce this
-        
-
-
-
-
+
+
+
-
-        </help>

tools/fasta_tools/fasta_concatenate_by_species.xml

@@ -1 @@
- FASTA
-
+
+FASTA 
-  <command interpreter="python">fasta_concatenate_by_species.py $input1 $out_file1</command>
-  <inputs>
@@ -15 +15 @@
-  </tests>
-  <help>
+  
+**What it does**
+  
-This tools attempts to parse FASTA headers to determine the species for each sequence in a multiple FASTA alignment.
-It then linearly concatenates the sequences for each species in the file, creating one sequence per determined species.
+
+-------
-
-**Example**
@@ -46 +51 @@
-
-
-B
+b
-  
-  >hg18

tools/fasta_tools/fasta_filter_by_length.xml

@@ -1 @@
- FASTA by Length
- 
+
+sequences by length
-        <command interpreter="python">fasta_filter_by_length.py $input $min_length $max_length $output </command>
-        <inputs>
-                <param name="input" type="data" format="fasta" label="Fasta file"/>
- of the return sequence
- of the return sequence" help="no limitation if 0
+
+" help="Setting to '0' will return all sequences longer than the 'Minimal length'
-        </inputs>
-        <outputs>
@@ -22 +22 @@
-.. class:: infomark
-
-If only want to show sequences longer than a threshold, set *minimal length* to the threshold and leave *maximum length* to zero
+To return sequences longer than a certain length, set *Minimal length* to desired value and leave *Maximum length* set to '0'
-
------
@@ -28 +28 @@
-**What it does**
-        
- This tool accepts two parameters: *minimal length* and *maximum length*, and returns sequences of length within the two thresholds
+Outputs sequences between *Minimal length* and *Maximum length*
- 
------
@@ -34 +34 @@
-**Example**
-
-- assume the input file contains fasta
+Suppose you have the following FASTA formatted
-
-        &gt;seq1
@@ -45 +45 @@
-        ATGGAAGC
-
-
+
-
-        &gt;seq1

tools/fasta_tools/fasta_to_tabular.py

@@ -14 +14 @@
-    infile = sys.argv[1]
-    outfile = sys.argv[2]
+    keep_first = int( sys.argv[3] ) + 1
-    title = ''
-    sequence = ''
-    sequence_count = 0
+    
+    if keep_first == 0:
+        keep_first = None
+
-    for i, line in enumerate( open( infile ) ):
-        line = line.rstrip( '\r\n' )
@@ -39 +44 @@
-    for i, fasta_title in title_keys:
-        sequence = seq_hash[( i, fasta_title )]
-
+[ 1:keep_first ]
-    out.close()
-

tools/fasta_tools/fasta_to_tabular.xml

@@ -1 +1 @@
-<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.0.0">
-Converts a FASTA file to T
-
+converts FASTA file to t
+ $keep_first
-        <inputs>
-
+
+
-        </inputs>
-        <outputs>
@@ -11 +12 @@
-                <test>
-                        <param name="input" value="454.fasta" />
+                        <param name="keep_first" value="0"/>
-                        <output name="output" file="fasta_to_tabular_out1.tabular" />
-                </test>
-                <test>
-                        <param name="input" value="4.fasta" />
+                        <param name="keep_first" value="0"/>
-                        <output name="output" file="fasta_to_tabular_out2.tabular" />
-                </test>
@@ -20 +23 @@
-        <help>
-        
+**What it does**
+
+This tool converts FASTA formatted sequences to TAB-delimited format. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 
+
+-----   
+
-**Example**
-
-A fasta file with two sequences
+Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run
-
-
-
-
-
+
+
+
+
+
-
-
+
+
+
+
-
-        &gt;seq1        CCGGTATCCG
-        &gt;seq2        CTTACC
-
-        </help>

tools/fasta_tools/tabular_to_fasta.xml

@@ -1 +1 @@
-<tool id="tab2fasta" name="Tabular-to-FASTA" version="1.1.0">
-Converts a
+converts
-        <command interpreter="python">tabular_to_fasta.py $input $title_col $seq_col $output </command>
-        <inputs>
@@ -20 +20 @@
-        <help>
-        
+**What it does**
+
+Converts tab delimited data into FASTA formatted sequences.
+
+-----------
+        
-**Example**
-
-olexa data
+uppose this is a sequence file produced by Illumina (Solexa) sequencer
-
-        5       300     902     419     GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
-        5       300     880     431     GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
-        
- and c4** as the Title Columns and **c5** as the Sequence Column
+** and **c4** as the **Title column(s)** and **c5** as the **Sequence column**
-
-        &gt;902_419